gp130 / IL6ST cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

gp130 / IL6ST cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2757 bp
Description
Full length Clone DNA of Rat interleukin 6 signal transducer with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

gp130 / IL6ST Background Information

Glycoprotein 13 (also known as gp13, IL6ST, IL6-beta or CD13) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD13/gp13 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD13/gp13 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD13/gp13 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp13 for initiating signal transmission. CD13/gp13 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD13/gp13 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.
Full Name
interleukin 6 signal transducer
References
  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait