Pcsk5 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

Pcsk5 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
5583 bp
Description
Full length Clone DNA of Human proprotein convertase subtilisin/kexin type 5
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Pcsk5 cDNA ORF Clone, Human, untagged: Alternative Names

PC5 cDNA ORF Clone, Human; PC6 cDNA ORF Clone, Human; PC6A cDNA ORF Clone, Human; RP11-422N19.4 cDNA ORF Clone, Human; SPC6 cDNA ORF Clone, Human; subtilase cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait