PPIL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

PPIL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
501 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus peptidylprolyl isomerase (cyclophilin)-like 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

PPIL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1110060O10Rik cDNA ORF Clone, Mouse; AI327391 cDNA ORF Clone, Mouse; Cypl1 cDNA ORF Clone, Mouse

PPIL1 Background Information

PPIL1 is a member of the cyclophilin family. Cyclophilins are well conserved and ubiquitous. Members of cyclophilin family take an significant part in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. PPIL1 is a peptidylprolyl isomerase(PPIase). It increases the folding of proteins and catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIL1 is involved in proliferation of cancer cells through modulation of phosphorylation of stathmin. It is a novel molecular target for colon-cancer therapy.
Full Name
peptidylprolyl isomerase (cyclophilin)-like 1
References
  • Xu C. et al., 2005, J Biomol NMR. 31 (2): 179-80.
  • Ozaki K. et al., 1997, Cytogenet Cell Genet. 72 (2-3): 242-5.
  • Mann SS. et al., 1999, Cytogenet Cell Genet. 83 (3-4): 228-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait