IMP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag

Price:
Size:
Number:

IMP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Mouse IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IMP4 cDNA ORF Clone, Mouse, N-OFPSpark® tag: Alternative Names

AA409888 cDNA ORF Clone, Mouse; AV031295 cDNA ORF Clone, Mouse; D1Wsu40e cDNA ORF Clone, Mouse

IMP4 Background Information

Full Name
IMP4, U3 small nucleolar ribonucleoprotein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait