IMPA1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

IMPA1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Mouse inositol (myo)-1(or 4)-monophosphatase 1
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About IMPA1

Entrez Gene ID

IMPA1 cDNA ORF Clone, Mouse, untagged: Alternative Names

2610002K09Rik cDNA ORF Clone, Mouse; 2900059K10Rik cDNA ORF Clone, Mouse; AI325909 cDNA ORF Clone, Mouse

IMPA1 Background Information

The IMPA1 gene product is responsible for the final step of biotransformation of inositol triphosphate and diacylglycerol, two second messengers. Despite its many physiological functions, no clinical phenotype has been assigned to this gene dysfunction to date. Additionally, IMPA1 is the main target of lithium, a drug that is at the forefront of treatment for bipolar disorder.
Full Name
inositol(myo)-1(or 4)-monophosphatase 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait