IL-F2/ILF2 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

IL-F2/ILF2 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Mouse interleukin enhancer binding factor 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-F2/ILF2 cDNA ORF Clone, Mouse, untagged: Alternative Names

6230405A16Rik cDNA ORF Clone, Mouse; TEG-267 cDNA ORF Clone, Mouse; Tex261 cDNA ORF Clone, Mouse; Tex267 cDNA ORF Clone, Mouse

IL-F2/ILF2 Background Information

Full Name
interleukin enhancer binding factor 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait