gp130 / IL6ST cDNA ORF Clone, Mouse, C-OFPSpark® tag

1/1
Price:
Size:
Number:

gp130 / IL6ST cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2754 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 6 signal transducer with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 3.44kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

gp130 / IL6ST cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

gp130 / IL6ST cDNA ORF Clone, Mouse, C-OFPSpark® tag: Validated Images

gp130 / IL6ST cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

5133400A03Rik cDNA ORF Clone, Mouse; AA389424 cDNA ORF Clone, Mouse; BB405851 cDNA ORF Clone, Mouse; CD130 cDNA ORF Clone, Mouse; D13Ertd699e cDNA ORF Clone, Mouse; gp130 cDNA ORF Clone, Mouse

gp130 / IL6ST Background Information

Glycoprotein 13 (also known as gp13, IL6ST, IL6-beta or CD13) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD13/gp13 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD13/gp13 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD13/gp13 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp13 for initiating signal transmission. CD13/gp13 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD13/gp13 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.
Full Name
interleukin 6 signal transducer
References
  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait