IL-1F5 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

IL-1F5 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Mouse interleukin 1 family, member 5 (delta) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-1F5 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

AI413231 cDNA ORF Clone, Mouse; FIL1delta cDNA ORF Clone, Mouse; IL-1H3 cDNA ORF Clone, Mouse; IL1HY1 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait