IL-27 cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

IL-27 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
705 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 27.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.71kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-27 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-27 cDNA ORF Clone, Mouse, untagged: Validated Images

IL-27 cDNA ORF Clone, Mouse, untagged: Alternative Names

IL-27 cDNA ORF Clone, Mouse; IL-27p28 cDNA ORF Clone, Mouse; Il30 cDNA ORF Clone, Mouse; p28 cDNA ORF Clone, Mouse

IL-27 Background Information

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p4-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.
Full Name
interleukin 27
References
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait