IL22 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

IL22 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
528 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation: 150 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse interleukin 22.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.53kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL22 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL22 cDNA ORF Clone, Mouse, untagged: Alternative Names

IL-22 cDNA ORF Clone, Mouse; IL-22a cDNA ORF Clone, Mouse; Iltif cDNA ORF Clone, Mouse; ILTIFa cDNA ORF Clone, Mouse

IL22 Background Information

IL22 is a member of a group of cytokines called the IL-1 family or IL-1 superfamily (including IL-19, IL-2, IL-24, and IL-26), a class of potent mediators of cellular inflammatory responses. It shares use of IL-1R2 in cell signaling with other members of this family, IL-1, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems. IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-1R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-1 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S1s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-1. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.
Full Name
interleukin 22
References
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait