IL21 cDNA ORF Clone, Mouse, N-HA tag

1/1
Price:
Size:
Number:

IL21 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
441 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 21 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.48kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL21 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL21 cDNA ORF Clone, Mouse, N-HA tag: Validated Images

IL21 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

IL-21 cDNA ORF Clone, Mouse

IL21 Background Information

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)
Full Name
interleukin 21
References
  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait