IL1RA cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

IL1RA cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Mouse interleukin 1 receptor antagonist with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL1RA cDNA ORF Clone, Mouse, N-His tag: Alternative Names

F630041P17Rik cDNA ORF Clone, Mouse; IL-1ra cDNA ORF Clone, Mouse

IL1RA Background Information

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.
Full Name
interleukin 1 receptor antagonist
References
  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.

IL1RA cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait