IL1RAPL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

IL1RAPL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2091 bp
Description
Full length Clone DNA of Mouse interleukin 1 receptor accessory protein-like 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL1RAPL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

6330532G10Rik cDNA ORF Clone, Mouse; C030039N24 cDNA ORF Clone, Mouse; IL1R8 cDNA ORF Clone, Mouse; IL1RAPL cDNA ORF Clone, Mouse; MRX34 cDNA ORF Clone, Mouse; OPHN4 cDNA ORF Clone, Mouse; TIGIRR-2 cDNA ORF Clone, Mouse

IL1RAPL1 Background Information

Interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) is a member of interleukin-1 receptor family. The protein structurally comprises three extracellular immunoglobulin domains, which presumably mediate binding of an as yet unidentified ligand, a transmembrane region, and an intracellular domain, which is likely to enable signalling via the NFkB pathway. The means of signalling is almost certain to be identical to that used by the IL1R family and the more distally related Toll protein. L1RAPL1 protein physically interacts via its 15 aa C-terminal domain with neuronal calcium sensor-1 (NCS-1), a protein widely expressed in neurons and the related chromaffin and PC12 cells. IL1RAPL1 is an integral membrane protein responsible for a nonsyndromic form of mental retardation (MR). It is suggested to affect human cognitive ability to some extent, especially the memory and concentration capability.
Full Name
interleukin 1 receptor accessory protein-like 1
References
  • Frdric Gambino, et al. (2007) IL1-receptor accessory protein-like 1 (IL1RAPL1), a protein involved in cognitive functions, regulates N-type Ca2+-channel and neurite elongation. Proc Natl Acad Sci. 104 (21): 9063-8.
  • Wheway JM, et al. (2003) A complex deletion-inversion-deletion event results in a chimeric IL1RAPL1-dystrophin transcript and a contiguous gene deletion syndrome. J Med Genet. 40: 127-131.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait