LILRB1 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

LILRB1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1959 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.96kb)
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LILRB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LILRB1 cDNA ORF Clone, Human, untagged: Validated Images

LILRB1 cDNA ORF Clone, Human, untagged: Alternative Names

CD85j cDNA ORF Clone, Human; ILT-2 cDNA ORF Clone, Human; ILT2 cDNA ORF Clone, Human; LIR-1 cDNA ORF Clone, Human; LIR1 cDNA ORF Clone, Human; MIR-7 cDNA ORF Clone, Human; MIR7 cDNA ORF Clone, Human; XXbac-BCX85G21.4 cDNA ORF Clone, Human

LILRB1 Background Information

Leukocyte immunoglobulin-like receptors (LILRs), also called CD85s, ILTs, or LIRs, are important mediators of immune activation and tolerance that contain tandem immunoglobulin (Ig)-like folds. LILRB1 is encoded within the leukocyte receptor complex on 19q13.4, previously implicated to be a susceptibility region to systemic lupus erythematosus (SLE).LILRB1 binds to a wide range of major histocompatibility complex class I molecules (MHCIs) and transduces negative signals that can, for example, prevent killing of MHCI-expressing cells.LILRB1 transcription is correlated with surface protein expression on NK cells.
Full Name
leukocyte immunoglobulin like receptor B1

LILRB1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait