ILDR1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

ILDR1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Description
Full length Clone DNA of Human immunoglobulin-like domain containing receptor 1
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About ILDR1

Entrez Gene ID

ILDR1 cDNA ORF Clone, Human, untagged: Alternative Names

DFNB42 cDNA ORF Clone, Human; ILDR1 cDNA ORF Clone, Human; ILDR1alpha cDNA ORF Clone, Human; ILDR1alpha' cDNA ORF Clone, Human; ILDR1beta cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait