IL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
540 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens interleukin 22.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

IL-21 cDNA ORF Clone, Human; IL-22 cDNA ORF Clone, Human; IL-D110 cDNA ORF Clone, Human; IL-TIF cDNA ORF Clone, Human; ILTIF cDNA ORF Clone, Human; TIFa cDNA ORF Clone, Human; TIFIL-23 cDNA ORF Clone, Human; zcyto18 cDNA ORF Clone, Human

IL22 Background Information

IL22 is a member of a group of cytokines called the IL-1 family or IL-1 superfamily (including IL-19, IL-2, IL-24, and IL-26), a class of potent mediators of cellular inflammatory responses. It shares use of IL-1R2 in cell signaling with other members of this family, IL-1, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems. IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-1R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-1 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S1s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-1. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.
Full Name
interleukin 22
References
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait