IL20RB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag

Price:
Size:
Number:

IL20RB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
936 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin20receptorbeta.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL20RB Background Information

IL2RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-1 family (interleukin-1, interleukin-2 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL2RB and IL2RA (MIM 6562) form a heterodimeric receptor for interleukin-2.
Full Name
interleukin 20 receptor beta
References
  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait