IL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

IL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
462 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens interleukin 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

IL-2 cDNA ORF Clone, Human; Interleukin-2 cDNA ORF Clone, Human; lymphokine cDNA ORF Clone, Human; TCGF cDNA ORF Clone, Human

IL2 Background Information

Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to theIL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced bymacrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.
Full Name
interleukin 2
References
  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait