eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1803 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.80kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2A/eIF2 alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag: Validated Images

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag: Alternative Names

CDA02 cDNA ORF Clone, Human; EIF-2A cDNA ORF Clone, Human; MST089 cDNA ORF Clone, Human; MSTP004 cDNA ORF Clone, Human; MSTP089 cDNA ORF Clone, Human

eIF2A/eIF2 alpha Background Information

Full Name
eukaryotic translation initiation factor 2A, 65kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait