eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CDA02 cDNA ORF Clone, Human; EIF-2A cDNA ORF Clone, Human; MST089 cDNA ORF Clone, Human; MSTP004 cDNA ORF Clone, Human; MSTP089 cDNA ORF Clone, Human

eIF2A/eIF2 alpha Background Information

Full Name
eukaryotic translation initiation factor 2A, 65kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait