PTTG1 cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

PTTG1 cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human pituitary tumor-transforming 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PTTG1 cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

EAP1 cDNA ORF Clone, Human; HPTTG cDNA ORF Clone, Human; PTTG cDNA ORF Clone, Human; TUTR1 cDNA ORF Clone, Human

PTTG1 Background Information

Full Name
pituitary tumor-transforming 1

PTTG1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait