PDLIM1 cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

PDLIM1 cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human PDZ and LIM domain 1 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About PDLIM1

Entrez Gene ID

PDLIM1 cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

CLIM1 cDNA ORF Clone, Human; CLP-36 cDNA ORF Clone, Human; CLP36 cDNA ORF Clone, Human; hCLIM1 cDNA ORF Clone, Human; HEL-S-112 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait