IL-5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/2
Price:
Size:
Number:

IL-5 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 5 (colony-stimulating factor, eosinophil) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.44kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-5 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

IL-5 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

EDF cDNA ORF Clone, Human; IL-5 cDNA ORF Clone, Human; Interleukin 5 cDNA ORF Clone, Human; TRF cDNA ORF Clone, Human

IL-5 Background Information

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.
Full Name
interleukin 5
References
  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait