IL-34 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/2
Price:
Size:
Number:

IL-34 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
729 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 34 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-34 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-34 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

IL-34 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

C16orf77 cDNA ORF Clone, Human; IL-34 cDNA ORF Clone, Human

IL-34 Background Information

Interleukin 34 (IL-34), also known as uncharacterized protein C16 or f77 homolog, is a secreted cytokine that belongs to unknown cytokine family. IL-34 protein is expressed in various tissues, including heart, brain, lung, liver, kidney, spleen, thymus, testes, ovary, small intestine, prostate and colon, and most abundant in the spleen. The colony-stimulating factor 1 receptor (CSF-1R) is identified as the receptor for IL-34. IL-34 increases growth or survival of immune cells known as monocytes. In addition, IL-34 promoted the formation of the colony-forming unit-macrophage (CFU-M), a macrophage progenitor, in human bone marrow cultures.
Full Name
interleukin 34
References
  • Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 320(5877): 807-11.

IL-34 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait