HK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

HK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2772 bp
Description
Full length Clone DNA of Human hexokinase 3 (white cell) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

HKIII cDNA ORF Clone, Human; HXK3 cDNA ORF Clone, Human

HK3 Background Information

Hexokinase-3, also known as Hexokinase type III, HKIII and HK3, is a protein which belongs to thehexokinase family. Hexokinase-3 / HK3 is anenzymewhich in humans is encoded by theHK2gene. Hexokinases phosphorylate glucoseto produceglucose 6-phosphate, committing glucose to theglycolytic pathway. In mammalian tissues hexokinase exists as four isoenzymes encoded by distinct genes. These proteins are homologous and are organized in two homologous domains, with the exception of hexokinase type IV which has only one. This organization is believed to be the result of a duplication and tandem fusion event involving the gene encoding for the ancestral hexokinase. The gene encodes hexokinase-3. Similar to hexokinases-1 and hexokinases-2, thisallostericenzyme is inhibited by its product glucose 6-phosphate.
Full Name
hexokinase 3 (white cell)
References
  • Palma F. et al., 1996, Mol Cell Biochem. 155: 23-9.
  • Furuta H. et al.,1996, Genomics. 36 (1): 206-9.
  • Colosimo A. et al.,1996, Cytogenet Cell Genet. 74 (3): 187-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait