ANK/ANKH cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

ANK/ANKH cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1479 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ankylosis, progressive homolog (mouse).
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.48kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ANK/ANKH cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANK/ANKH cDNA ORF Clone, Human, untagged: Validated Images

ANK/ANKH cDNA ORF Clone, Human, untagged: Alternative Names

ANK cDNA ORF Clone, Human; CCAL2 cDNA ORF Clone, Human; CMDJ cDNA ORF Clone, Human; CPPDD cDNA ORF Clone, Human; HANK cDNA ORF Clone, Human; MANK cDNA ORF Clone, Human

ANK/ANKH Background Information

Full Name
ANKH inorganic pyrophosphate transport regulator

ANK/ANKH cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait