TMP21 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag

Price:
Size:
Number:

TMP21 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Ferret transmembrane emp24-like trafficking protein 10 (yeast) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TMP21 Background Information

TMED1 disrupts the complex formation between TGF-beta type I (also termed ALK5) and type II receptors (TbetaRII). Misexpression studies revealed that TMED1 attenuated TGF-beta-mediated signaling. A 2-amino acid-long region from Thr(91) to Glu(11) within the extracellular region of TMED1 was found to be crucial for TMED1 interaction with both ALK5 and TbetaRII. Synthetic peptides corresponding to this region inhibit both TGF-beta-induced Smad2 phosphorylation and Smad-dependent transcriptional reporter activity. In a xenograft cancer model, where previously TGF-beta was shown to elicit tumor-promoting effects, gain-of-function and loss-of-function studies for TMED1 revealed a decrease and increase in the tumor size, respectively. That TMED1 expression levels are the key determinant for efficiency of TGF-beta receptor complex formation and signaling.
Full Name
transmembrane emp24-like trafficking protein 10 (yeast)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait