IL-34 cDNA ORF Clone, Canine, C-OFPSpark® tag

Price:
Size:
Number:

IL-34 cDNA ORF Clone, Canine, C-OFPSpark® tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Canine interleukin 34 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-34 Background Information

Interleukin 34 (IL-34), also known as uncharacterized protein C16 or f77 homolog, is a secreted cytokine that belongs to unknown cytokine family. IL-34 protein is expressed in various tissues, including heart, brain, lung, liver, kidney, spleen, thymus, testes, ovary, small intestine, prostate and colon, and most abundant in the spleen. The colony-stimulating factor 1 receptor (CSF-1R) is identified as the receptor for IL-34. IL-34 increases growth or survival of immune cells known as monocytes. In addition, IL-34 promoted the formation of the colony-forming unit-macrophage (CFU-M), a macrophage progenitor, in human bone marrow cultures.
Full Name
interleukin 34
References
  • Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 320(5877): 807-11.

IL-34 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait