IL-33 cDNA ORF Clone, Canine, untagged

Price:
Size:
Number:

IL-33 cDNA ORF Clone, Canine, untagged: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Canine interleukin 33.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-33 Background Information

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.
Full Name
interleukin 33
References
  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.

IL-33 cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait