14-3-3 epsilon Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

14-3-3 epsilon Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
768 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

14-3-3 epsilon Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AU019196 cDNA ORF Clone, Mouse

14-3-3 epsilon Background Information

YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 epsilon / YWHAE is found in both plants and mammals, and this protein is 1% identical to the mouse ortholog. YWHAE interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 epsilon / YWHAE is implicated in the regulation of a large spectrum of both general and specialized signaling pathways. 14-3-3 epsilon / YWHAE Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. This Binding generally results in the modulation of the activity of the binding partner.
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon
References
  • Ikeda M, et al. (2008) Identification of YWHAE, a gene encoding 14-3-3epsilon, as a possible susceptibility gene for schizophrenia. Hum Mol Genet. 17(20): 3212-22.
  • Mignon-Ravix C, et al. (2010) Deletion of YWHAE in a patient with periventricular heterotopias and pronounced corpus callosum hypoplasia. J Med Genet. 47(2): 132-6.
  • Nagamani SC, et al. (2009) Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment. J Med Genet. 46(12): 825-33.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait