TNFSF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

TNFSF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

TNFSF18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

AITRL cDNA ORF Clone, Human; GITRL cDNA ORF Clone, Human; hGITRL cDNA ORF Clone, Human; TL6 cDNA ORF Clone, Human

TNFSF18 Background Information

The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.
Full Name
tumor necrosis factor (ligand) superfamily, member 18
References
  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto’s Thyroiditis. Nicot C, ed. International Journal of Molecular Sciences. 2014;15(12):21674-21686.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait