Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-HA tag

Price:
Size:
Number:

Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-HA tag: General Information

Gene
Species
RVFV
NCBI Ref Seq
RefSeq ORF Size
798 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rift Valley fever virus (RVFV) (strain MP12) NSs with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRRSV Non-structural protein cDNA ORF Clone, RVFV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait