Her2 / ERBB2 cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

Her2 / ERBB2 cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3780 bp
Description
Full length Clone DNA of Rat v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Her2 / ERBB2 Background Information

Epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD34, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.
Full Name
erb-b2 receptor tyrosine kinase 2
References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait