CD28 cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

CD28 cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Rat Cd28 molecule with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD28 Background Information

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.
Full Name
CD28 molecule
References
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait