Lentiviral Vector pLV-C-GFPSpark®

pLV-C-GFPSpark® Physical Map
Download sequence
pLV-C-GFPSpark® Physical Map

Schematic of pLV-C-GFPSpark® Multiple Cloning Sites

Schematic of pLV-C-GFPSpark® Multiple Cloning Sites

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Lentiviral Vector pLV-C-GFPSpark® Information Description

Vector Name pLV-C-GFPSpark®
Vector Size 7395bp
Vector Type Lentiviral Vector
Promoter Enhancer CMV
Antibiotic Resistance Ampicillin
Protein Tag GFPSpark®
Sequencing Primer F: pLen-F(CTCGTTTAGTGAACCGTCAGAATT)
R: pLen-R(GAACCGGAACCCTTAAACATGT)

GFPSpark® Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Lentiviral vector types

More about lentiviral vector

More reagents and services