pCMV3-C-FLAG Negative Control Vector (C-terminal FLAG-tagged)

  • Negative control for the pCMV3-C-FLAG clone.
  • Vector sequence is the same as pCMV3-C-FLAG, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-FLAG-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-FLAG-NCV
 Vector Size

6013bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag FLAG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-FLAG-NCV (Negative Control Vector) Multiple Cloning Sites

  • A viral microRNA downregulates metastasis suppressor CD82 and induces cell invasion and angiogenesis by activating the c-Met signaling
    Author
    Li, W;Hu, M;Wang, C;Lu, H;Chen, F;Xu, J;Shang, Y;Wang, F;Qin, J;Yan, Q;Krueger, BJ;Renne, R;Gao, SJ;Lu, C;
    Year
    2017
    Journal
    Oncogene
Add to Cart Successfully Add to Cart Failed