TCEANC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

TCEANC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Mouse transcription elongation factor A (SII) N-terminal and central domain containing 2 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TCEANC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2210010B22Rik cDNA ORF Clone, Mouse; 2210012G02Rik cDNA ORF Clone, Mouse; 6330404A07Rik cDNA ORF Clone, Mouse; AU015593 cDNA ORF Clone, Mouse; Tdeanc2 cDNA ORF Clone, Mouse

TCEANC2 Background Information

Full Name
transcription elongation factor A (SII) N-terminal and central domain containing 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait