tPA cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

tPA cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2409 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse plasminogen activator, tissue with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI(6kb+2.41kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

tPA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

tPA cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

tPA cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AU020998 cDNA ORF Clone, Mouse; AW212668 cDNA ORF Clone, Mouse; D8Ertd2e cDNA ORF Clone, Mouse; tPA cDNA ORF Clone, Mouse

tPA Background Information

Tissue plasminogen activator (abbreviated tPA or PLAT), is traditionally viewed as a simple serine protease whose main function is to convert plasminogen into biologically active plasmin. As a protease, tPA plays a crucial role in regulating blood fibrinolysis, in maintaining the homeostasis of extracellular matrix and in modulating the post-translational activation of growth factors. tPA is synthesized and secreted as a single chain polypeptide precursor which is cleaved in turn by plasmin. Proteolytic cleavage at the C-terminal side of Arg275 generates the enzyme composed of two subunits, designated as α and β chains which are held together by a single disulfide bond. Unlike the other members of the chymotrypsin family, tPA has one particular distinction in that the catalytic efficiency of the single-chain enzyme is only slightly lower than that of the proteolytically cleaved form and is therefore not a true zymogen. tPA is found not only in the blood, where its primary function is as a thrombolytic enzyme, but also in the central nervous system (CNS). It participats in a number of physiological and pathological events in the CNS, as well as the role of neuroserpin as the natural regulator of tPA's activity in these processes. Increased or decreased activity of tPA leads to hyperfibrinolysis or hypofibrinolysis, respectively. In addition, as a cytokine, tPA plays a pivotal role in the pathogenesis of renal interstitial fibrosis through diverse mechanisms. Thus, as a fibrogenic cytokine, it promotes the progression of kidney diseases.
Full Name
plasminogen activator, tissue
References
  • Yepes M, et al. (2004) New functions for an old enzyme: nonhemostatic roles for tissue-type plasminogen activator in the central nervous system. Exp Biol Med (Maywood). 229(11): 1097-104.
  • Samson AL, et al. (2006) Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron. 50(5): 673-8.
  • Skrzypiec AE, et al. (2008) Tissue plasminogen activator in the amygdala: a new role for an old protease. J Physiol Pharmacol. 59 Suppl 8: 135-46.
  • Hu K, et al. (2008) Novel actions of tissue-type plasminogen activator in chronic kidney disease. Front Biosci. 13: 5174-86.

tPA cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait