MMP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

MMP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1422 bp
Description
Full length Clone DNA of Mouse matrix metallopeptidase 12 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About MMP12

Entrez Gene ID

MMP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

AV378681 cDNA ORF Clone, Mouse; Mmel cDNA ORF Clone, Mouse

MMP12 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to thepeptidase M1A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type II-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.
Full Name
matrix metallopeptidase 12
References
  • Shapiro S.D., et al.,(1993), Cloning and characterization of a unique elastolytic metalloproteinase produced by human alveolar macrophages. J. Biol. Chem. 268:23824-23829.
  • Gronski T.J. Jr., et al., (1997), Hydrolysis of a broad spectrum of extracellular matrix proteins by human macrophage elastase.J. Biol. Chem. 272:12189-12194.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait