MAP1LC3A cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

MAP1LC3A cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
366 bp
Description
Full length Clone DNA of Mouse microtubule-associated protein 1 light chain 3 alpha with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About MAP1LC3A

Entrez Gene ID

MAP1LC3A cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1010001H21Rik cDNA ORF Clone, Mouse; 4922501H04Rik cDNA ORF Clone, Mouse; LC3 cDNA ORF Clone, Mouse; LC3a cDNA ORF Clone, Mouse

MAP1LC3A Background Information

LC3A, also known as MAP1LC3A, is one of the light chain subunits that functions together with both MAP1A and/or MAP1B. MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. As a light chain subunit, MAP1LC3A has an important part in neuronal development and in maintaining the balance between neuronal plasticity and rigidity. MAP1LC3A is expressed as two alternatively spliced isoforms that are expressed in testis, brain, heart, liver and skeletal muscle, but are absent in thymus and peripheral blood leukocytes.
Full Name
microtubule-associated protein 1 light chain 3 alpha
References
  • He H., et al.,(2003), Post-translational modifications of three members of the human MAP1LC3 family and detection of a novel type of modification for MAP1LC3B. J. Biol. Chem. 278:29278-29287.
  • Deloukas P., et al., (2001), The DNA sequence and comparative analysis of human chromosome 20.Nature 414:865-871.
  • Bechtel S., et al.,(2007), The full-ORF clone resource of the German cDNA consortium.BMC Genomics 8:399-399.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait