EGFR cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

EGFR cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3633 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 40 T/C, 1725 A/G and 2799 G/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse epidermal growth factor receptor with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI (6kb + 3.68kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EGFR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFR cDNA ORF Clone, Mouse, C-His tag: Validated Images

EGFR cDNA ORF Clone, Mouse, C-His tag: Alternative Names

9030024J15Rik cDNA ORF Clone, Mouse; AI552599 cDNA ORF Clone, Mouse; Erbb cDNA ORF Clone, Mouse; Errb1 cDNA ORF Clone, Mouse; Errp cDNA ORF Clone, Mouse; wa-2 cDNA ORF Clone, Mouse; wa2 cDNA ORF Clone, Mouse; Wa5 cDNA ORF Clone, Mouse

EGFR Background Information

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.
Full Name
epidermal growth factor receptor
References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait