EGF cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/2
Price:
Size:
Number:

EGF cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse epidermal growth factor with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 4.38kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EGF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGF cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

EGF cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI790464 cDNA ORF Clone, Mouse

EGF Background Information

EGF is the founding member of the EGF-family of proteins. Members of this protein family have highly similar structural and functional characteristics. EGF contains 9 EGF-like domains and 9 LDL-receptor class B repeats. Human EGF is a 645-Da protein with 53 amino acid residues and three intramolecular disulfide bonds. As a low-molecular-weight polypeptide, EGF was first purified from the mouse submandibular gland, but since then it was found in many human tissues including submandibular gland, parotid gland. It can also be found in human platelets, macrophages, urine, saliva, milk, and plasma. EGF is a growth factor that stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. It results in cellular proliferation, differentiation, and survival. Salivary EGF, which seems also regulated by dietary inorganic iodine, also plays an important physiological role in the maintenance of oro-esophageal and gastric tissue integrity. EGF acts by binding with high affinity to epidermal growth factor receptor on the cell surface and stimulating the intrinsic protein-tyrosine kinase activity of the receptor. The tyrosine kinase activity, in turn, initiates a signal transduction cascade that results in a variety of biochemical changes within the cell - a rise in intracellular calcium levels, increased glycolysis and protein synthesis, and increases in the expression of certain genes including the gene for EGFR - that ultimately lead to DNA synthesis and cell proliferation.
Full Name
epidermal growth factor
References
  • Chen JX, et al. (2011) Involvement of c-Src/STAT3 signal in EGF-induced proliferation of rat spermatogonial stem cells. Mol Cell Biochem. 358(1-2):67-73.
  • Guo Y, et al. (2012) Correlations among ERCC1, XPB, UBE2I, EGF, TAL2 and ILF3 revealed by gene signatures of histological subtypes of patients with epithelial ovarian cancer. Oncol Rep. 27(1):286-92.
  • Kim S, et al. (2012) Smad7 acts as a negative regulator of the epidermal growth factor (EGF) signaling pathway in breast cancer cells. Cancer Lett. 314(2):147-54.
  • Chatterton RT Jr, et al. (2010) Breast ductal lavage for assessment of breast cancer biomarkers. Horm Cancer. 1(4):197-204.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait