DDR1 cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

DDR1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2625 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1296C/T,1344T/C,1452G/A,1596A/G,1641C/T,2247C/T,2505C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse discoidin domain receptor family, member 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+2.63kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DDR1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDR1 cDNA ORF Clone, Mouse, untagged: Validated Images

DDR1 cDNA ORF Clone, Mouse, untagged: Alternative Names

6030432F18 cDNA ORF Clone, Mouse; AI323681 cDNA ORF Clone, Mouse; Cak cDNA ORF Clone, Mouse; CD167a cDNA ORF Clone, Mouse; Nep cDNA ORF Clone, Mouse; PTK3A cDNA ORF Clone, Mouse

DDR1 Background Information

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 1 (MCK1), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK1/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK1/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.
Full Name
discoidin domain receptor tyrosine kinase 1
References
  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.

DDR1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait