B7-H4 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

B7-H4 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
852 bp
Description
Full length Clone DNA of Mouse V-set domain containing T cell activation inhibitor 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

B7-H4 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

B7h4 cDNA ORF Clone, Mouse; B7s1 cDNA ORF Clone, Mouse; B7x cDNA ORF Clone, Mouse; BC032925 cDNA ORF Clone, Mouse

B7-H4 Background Information

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL1 / interleukin-1 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.
Full Name
V-set domain containing T cell activation inhibitor 1
References
  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.

B7-H4 cDNA ORF Clone, Rat, Related Products

B7-H4 cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait