ABP1 / AOC1 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

ABP1 / AOC1 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2271 bp
Description
Full length Clone DNA of Mouse amine oxidase, copper-containing 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About ABP1 / AOC1

Entrez Gene ID

ABP1 / AOC1 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

1600012D06Rik cDNA ORF Clone, Mouse; Abp1 cDNA ORF Clone, Mouse; DAO cDNA ORF Clone, Mouse

ABP1 / AOC1 Background Information

Amine oxidase copper-containing 1 (AOC1; formerly known as amiloride-binding protein 1) is a secreted glycoprotein that catalyzes the degradation of putrescine and histamine. Polyamines and their diamine precursor putrescine are ubiquitous to all organisms and fulfill pivotal functions in cell growth and proliferation. That the Wilms tumor protein, WT1, which is necessary for normal kidney development, activates transcription of the AOC1 gene. Expression of a firefly luciferase reporter under control of the proximal AOC1 promoter was significantly enhanced by co-transfection of a WT1 expression construct. Binding of WT1 protein to a cis-regulatory element in the AOC1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. WT1-dependent control of polyamine breakdown, which is mediated by changes in AOC1 expression, has a role in kidney organogenesis.
Full Name
amine oxidase, copper containing 1

ABP1 / AOC1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait