ABHD4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

ABHD4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Mouse abhydrolase domain containing 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABHD4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

1110035H23Rik cDNA ORF Clone, Mouse; Abh4 cDNA ORF Clone, Mouse; AI429574 cDNA ORF Clone, Mouse

ABHD4 Background Information

Abhydrolase domain containing 4 (ABHD4), also known as alpha/beta-hydrolase 4 (ABH4) , or lyso-N-acylphosphatidylethanolamine lipase, which belongs to the ABHD4/ABHD5 subfamily of peptidase S33 family. Abhydrolase domain containing (ABHD) gene was a small group belongs to alpha/beta hydrolase superfamily. Known members of this group are all found to be involved in important biochemical processes and related to various diseases. The alpha/beta-hydrolase 4 (ABH4) is a lysophospholipase/phospholipase B that selectively hydrolyzes N-acyl phosphatidylethanolamines (NAPEs) and lysoNAPEs. ABH4 accepts lysoNAPEs bearing both saturated and polyunsaturated N-acyl chains as substrates and displays a distribution that closely mirrors lysoNAPE-lipase activity in mouse tissues. The existence of an NAPE-PLD-independent route for NAE biosynthesis and suggest that ABH4 plays a role in this metabolic pathway by acting as a (lyso)NAPE-selective lipase.
Full Name
abhydrolase domain containing 4
References
  • Li F, et al. (2009) An unannotated alpha/beta hydrolase superfamily member, ABHD6 differentially expressed among cancer cell lines. Mol Biol Rep. 36(4): 691-6.
  • Simon G.M, et al. (2006) Endocannabinoid biosynthesis proceeding through glycerophospho-N-acyl ethanolamine and a role for alpha/beta hydrolase 4 in this pathway. J. Biol. Chem. 281: 26465-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait