AARSD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/1
Price:
Size:
Number:

AARSD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1968 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse alanyl-tRNA synthetase domain containing 1 with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + NotI(6kb+1.97kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

AARSD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AARSD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

AARSD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

1110069E20Rik cDNA ORF Clone, Mouse; 2310044P18Rik cDNA ORF Clone, Mouse; AA589600 cDNA ORF Clone, Mouse; AlaX cDNA ORF Clone, Mouse; AlaXp-II cDNA ORF Clone, Mouse

AARSD1 Background Information

AARSD1 belongs to the class-II aminoacyl-tRNA synthetase family, Alax-L subfamily. AARSD1 binds 1 zinc ion per subunit functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). Four transcript variants have been described for AARSD1: NM_25267.3, NM_113642.2, NM_1142653.1 and NM_1142654.1. It has been determined that the latter two variants represent a distinct upstream locus, which is now represented by GeneID:1885848 (PTGES3L), while the former two variants represent readthrough transcripts between PTGES3L and this locus (AARSD1). The readthrough locus (PTGES3L-AARSD1) is now represented by GeneID:188585.
Full Name
alanyl-tRNA synthetase domain containing 1
References
  • Tatham MH, et al. (2011) Comparative proteomic analysis identifies a role for SUMO in protein quality control. Oncogene. 19(17):2120-8.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.

AARSD1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait