L1CAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

L1CAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3780 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus L1 cell adhesion molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

L1CAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

CD171 cDNA ORF Clone, Mouse; L1 cDNA ORF Clone, Mouse; N-CAM-L1 cDNA ORF Clone, Mouse; NCAM-L1 cDNA ORF Clone, Mouse

L1CAM Background Information

L1 cell adhesion molecule (L1CAM), also designated as CD171, is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. L1CAM interacts with a variety of ligands including axonin-1, CD9, neurocan and intergrins, and it has been revealed that the RGD motif in the sixth Ig domain of L1CAM is a binding site for integrins, thus important for nuclear signaling. Disruption of L1CAM function causes three X-linked neurological syndromes, i.e. hydrocephalus, MASA syndrome (mental retardation, aphasia, shuffling gait and adducted thumbs) and spastic paraplegia syndrome. Overexpression of L1CAM in normal and cancer cells increased motility, enhanced growth rate and promoted cell transformation and tumorigenicity. Recent work has identified L1CAM (CD171) as a novel marker for human carcinoma progression, and a candidate for anti-cancer therapy.
Full Name
L1 cell adhesion molecule
References
  • Meier F, et al. (2006) The adhesion molecule L1 (CD171) promotes melanoma progression. Int J Cancer. 119(3): 549-55.
  • Gavert N, et al. (2008) L1-CAM in cancerous tissues. Expert Opin Biol Ther. 8(11): 1749-57.
  • Issa Y, et al. (2009) Enhanced L1CAM expression on pancreatic tumor endothelium mediates selective tumor cell transmigration. J Mol Med. 87(1): 99-112.
  • Weidle UH, et al. (2009) L1-CAM as a target for treatment of cancer with monoclonal antibodies. Anticancer Res. 29(12): 4919-31.
  • Raveh S, et al. (2009) L1 cell adhesion molecule (L1CAM) in invasive tumors. Cancer Lett. 282(2): 137-45.
  • Wolterink S, et al. (2010) Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. 70(6): 2504-15.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait