FLT4 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

1/2
Price:
Size:
Number:

FLT4 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3897 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fms-related tyrosine kinase 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6kb + 3.91kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

FLT4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLT4 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

FLT4 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

FLT-4 cDNA ORF Clone, Human; FLT-41 cDNA ORF Clone, Human; FLT41 cDNA ORF Clone, Human; LMPH1A cDNA ORF Clone, Human; PCL cDNA ORF Clone, Human; VEGF Receptor 3 cDNA ORF Clone, Human; VEGFR-3 cDNA ORF Clone, Human; VEGFR3 cDNA ORF Clone, Human

FLT4 Background Information

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.
Full Name
fms related tyrosine kinase 4
References
  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • uPARAP/Endo180 receptor is a gatekeeper of VEGFR-2/VEGFR-3 heterodimerisation during pathological lymphangiogenesis
    Author
    Durré, T;Morfoisse, F;Erpicum, C;Ebroin, M;Blacher, S;García-Caballero, M;Deroanne, C;Louis, T;Balsat, C;Van de Velde, M;Kaijalainen, S;Kridelka, F;Engelholm, L;Struman, I;Alitalo, K;Behrendt, N;Paupert, J;Noel, A;
    Year
    2018
    Journal
    Nat Commun
    Application
    expression
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait