A20 / TNFAIP3 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

A20 / TNFAIP3 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2373 bp
Description
Full length Clone DNA of Human tumor necrosis factor, alpha-induced protein 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

A20 / TNFAIP3 cDNA ORF Clone, Human, C-HA tag: Alternative Names

A20 cDNA ORF Clone, Human; OTUD7C cDNA ORF Clone, Human; TNFA1P2 cDNA ORF Clone, Human

A20 / TNFAIP3 Background Information

TNFAIP3, also named A2, uses ubiquitin-related functions to regulate immune activation, deficiency of which is highly related to autoimmune disease. Mutations in tumor necrosis factor alpha-induced protein 3 (TNFAIP3), a key player in the negative feedback regulation of nuclear factor-kappaB signaling, have recently been recognized as leading to early onset autoinflammatory and autoimmune syndrome.
Full Name
tumor necrosis factor, alpha-induced protein 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait